Custirsen treatment with reduced toxicity
Number of patents in Portfolio can not be more than 2000
United States of America Patent
Stats
-
Jun 14, 2016
Grant Date -
Sep 18, 2014
app pub date -
Mar 12, 2014
filing date -
Mar 14, 2013
priority date (Note) -
Withdrawn
status (Latency Note)
Importance
Abstract
The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg. The present invention also provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of myeloma.
First Claim
Family
International Classification(s)
Cited Art Landscape
Patent Citation Ranking
Recipient Email Address
Recipient Email Address
Comment
Recipient Email Address
Add to Portfolio(s)
To add this patent to one, or more, of your portfolios, simply click the add button.
This Patent is in these Portfolios:
Add to additional portfolios:
Last Refreshed On:
Changes done successfully