Anti-clusterin monotherapy for cancer treatment
Number of patents in Portfolio can not be more than 2000
United States of America Patent
Stats
-
Jun 7, 2016
Grant Date -
Sep 18, 2014
app pub date -
Mar 12, 2014
filing date -
Mar 14, 2013
priority date (Note) -
Withdrawn
status (Latency Note)
Importance
Abstract
The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19.
First Claim
Family
International Classification(s)
Cited Art Landscape
Patent Citation Ranking
Recipient Email Address
Recipient Email Address
Comment
Recipient Email Address
Add to Portfolio(s)
To add this patent to one, or more, of your portfolios, simply click the add button.
This Patent is in these Portfolios:
Add to additional portfolios:
Last Refreshed On:
Changes done successfully