Detection of HLA-DR
Number of patents in Portfolio can not be more than 2000
United States of America Patent
Stats
-
Aug 17, 1999
Issued Date -
N/A
app pub date -
Sep 15, 1997
filing date -
Mar 10, 1995
priority date (Note) -
Expired
status (Latency Note)
Importance
Abstract
A probe set is provided which can assay larger amounts of samples in a simpler manner and enables typing of all HLA-DR types currently known to be present in Japanese. The probe set comprises part or all of oligonucleotides having the following sequences 1 to 16 or complementary strands thereof: sequence 1: CGGTTGCTCGGAAAGATGCATC sequence 2: ACACTCCCTCTTTGGCTG sequence 3: GGCCGGGTGGACAACTAC sequence 4: ATGTTTAACCTGCTCCAA sequence 5: CCTGATGAGGAGTACTGGAA sequence 6: AGCTACTGCGCTTCGAC sequence 7: CGTAGAGTACTCCAAGAA sequence 8: CTTATACTTACCCTGCCA sequence 9: AGACAGGCGGGCCCT sequence 10: TCAAACTTATCCTGCTTC sequence 11: AAACTTAACCTCCTCCAA sequence 12: ACTCTACGTCTGAGTGTC sequence 13: ACGGGTGAGTGTTATTTC sequence 14: GACCTCCTGGAAGACAGG sequence 15: ACATCCTGGAAGACGAGC sequence 16: CCCGTAGTTGTGTCTGCA.
First Claim
Family
International Classification(s)
Cited Art Landscape
Patent Citation Ranking
Recipient Email Address
Recipient Email Address
Comment
Recipient Email Address
Add to Portfolio(s)
To add this patent to one, or more, of your portfolios, simply click the add button.
This Patent is in these Portfolios:
Add to additional portfolios:
Last Refreshed On:
Changes done successfully