Method and kit for detecting methicillin-resistant Staphylococcus aureus
Number of patents in Portfolio can not be more than 2000
United States of America Patent
Stats
-
Dec 30, 1997
Grant Date -
N/A
app pub date -
Jan 16, 1996
filing date -
Jan 19, 1995
priority date (Note) -
Expired
status (Latency Note)
Importance
Abstract
A method and a kit for detecting methicillin-resistant Staphylococcus aureus which use, as primers in a gene amplification reaction, the four oligonucleotides represented by the following nucleotide sequences (1) through (4): 5'AGAAATGACTGAACGTCCG3' (SEQ ID NO:1) (1) 5'GCGATCAATGTTACCGTAG3' (SEQ ID NO:2) (2) 5'TACATGTCGTTAAACCTGGTG3' (SEQ ID NO:3) (3) 5'TACAGTTGTACCGATGAATGG3' (SEQ ID NO:4) (4) wherein A, G, C, and T denote adenine, guanine, cytosine, and thymine, respectively, and any T may be substituted by uracil (U). According to the method and kit of the present invention, it is possible to detect MRSA accurately and rapidly while distinguishing it from MR-CNS. Thus, proper treatment and prevention can be achieved against MRSA infections.
First Claim
Family
International Classification(s)
Cited Art Landscape
Patent Citation Ranking
Recipient Email Address
Recipient Email Address
Comment
Recipient Email Address
Add to Portfolio(s)
To add this patent to one, or more, of your portfolios, simply click the add button.
This Patent is in these Portfolios:
Add to additional portfolios:
Last Refreshed On:
Changes done successfully