Detection for Staphylococcus spp.
Number of patents in Portfolio can not be more than 2000
United States of America Patent
Stats
-
Aug 1, 1995
Grant Date -
N/A
app pub date -
Aug 4, 1992
filing date -
Aug 5, 1991
priority date (Note) -
Expired
status (Latency Note)
Importance
Abstract
The present invention discloses a primer for detecting methicillin-resistant or toxic shock syndrome toxin-1 Staphylococcus spp. comprising any one of nucleotide fragments of sequences (1) to (4): 5'GAAATGACTGAACGTCCGAT (1) 5'GCGATCAATGTTACCGTAGT (2) 5'AGTATGGGCCAAAGTTCGAT (3) 5'CACTTTGATATGTGGATCCG (4) a method and kit for detecting these bacteria using the primer. The present invention makes direct and rapid detection of MRS and/or TPS from samples possible, and enables patients with infections caused by these bacteria to be treated at an early stage.
First Claim
Family
International Classification(s)
- [Classification Symbol]
- [Patents Count]
Cited Art Landscape
Patent Citation Ranking
Recipient Email Address
Recipient Email Address
Comment
Recipient Email Address
Add to Portfolio(s)
To add this patent to one, or more, of your portfolios, simply click the add button.
This Patent is in these Portfolios:
Add to additional portfolios:
Last Refreshed On:
Changes done successfully